Lirik"Bidadari Keseleo" dari Via Vallen ini dipublikasikan pada tanggal 4 September 2017 (5 tahun yang lalu).Single ini didistribusikan oleh label Mega Records. Sebelumnya, lagu ini pernah dibawakan oleh Sukir Genk. Berikut cuplikan syair nyanyian / teks dari lagunya: "untumu ono kawate ono lomboke, ono kangkunge yen mrenges ketok aslimu ketok wagumu, ketok mrongosmu bidadari keseleo mekso album Simplified info_outline Major & minor chords only visibility 123 album Advanced info_outline Includes 6,7,aug,hdim7 chords visibility 123 album Bass info_outline Advance chords for bass visibility 123 album Edited info_outline All Edited versions visibility 123 album Chords Notes info_outline Notes in chords visibility 123 album Simple Notes info_outline Rhythm of the song visibility 123 album Bass Notes info_outline Sheet music of bass visibility 123 album Music Notes info_outline Sequence of instrument notes visibility 123 close aspect_ratio arrow_drop_down Show all diagrams layers Edit Lyrics cloud_done Save cancel Cancel Edit delete_forever Delete this Version 3/4Time Signature arrow_back0SHIFT arrow_forward BPM doneclose CCCCCCAmCCCCCCCCCFmCCCCCmCCCDCCCCmCCCCCCCGCCCCCCCACCCCCCCDCCCCCCCCmCCCCCCCCGCCCCCCCACCCCCCCDCCCCCCCCmCCCCCCCGCCCCCCCACCCCCCCDCCCCCCCCmCCCCCCCGCCCCCCCACCCCCCCDCCCCCCFCCCCCCmCCGCCCCCCCACCCCCCCDCCCCCCCCmCCCCCCCGCCCCCCCACCCCCCCDCCCCCCCCmCCCCCCCGCCCCCCCACCCCCCCDCCCCCCCCmCCCCCCCGCCCCCCCACCCCCCCDCCCCCCCCmCCCCCCCGCCCCCCCACCCCCCCDCCCCCCCCCCCCCCCGCCCCCCCACCCCCCCDCCCCCCCCCCCCCCCGCCCCCCCACCCCCCCDCCCCCCCCmCCCCCCCGCCCCCCCACCCCCCCDCCCCCCFCCCCCmCCCGCCCCCCCACCCCCCCDCCCCCCCCmCCCCCCCGCCCCCCCACCCCCCCDCCCCCCCCmCCCCCCCGCCCCCCCACCCCCCCDCCCCCCCCmCCCCCCCGCCCCCCCACCCCCCCDCCCCCCCCmCCCCCCCGCCCCCCCACCCCFCCDCCCCCCCCCCCCCCCGCCCCCCCACCCCCCCDCCCCCCCCCCCCCCCGCCCCCCCACCCCCCCDCCCCCCCCCCFCCCCGCCCCCCCACCCCCCCFCCCCCCCCCCCCmCCCGCCCCCCCACCCCCCCDCCCCCCCCmCCCCCCCGCCCCCCCACCCCCCCDCCCCCCCCmCCCCCCCGCCCCCCCACCCCCCCCCCCCCCCCCCCCCCCCCCCCCCCCCCCCCCCCCCCCCCCCCCCCCCCCN Private lock Publiclanguage file_download PDF & Tabs music_note Download Midi clear ChordU Learn Any Instrument ChordU has always been about simplicity and ease of access. We are constantly improving our accuracy through research and development. We hope you have a wonderful experience with us. Hello Again !! Please login to your ChordU account. mail Login with Email Forgot Password? Don't have an account? Sign Up trending_flat clearsecurity Forgot Password No worries, enter your registered email to reset your password keyboard_backspace Back to Login

LirikLagu Bidadari Keseleo - Via Vallen, Lengkap dengan Chord Kunci Gitar: Intro : D Bm G

album Simplified info_outline Major & minor chords only visibility 123 album Advanced info_outline Includes 6,7,aug,hdim7 chords visibility 123 album Bass info_outline Advance chords for bass visibility 123 album Edited info_outline All Edited versions visibility 123 album Chords Notes info_outline Notes in chords visibility 123 album Simple Notes info_outline Rhythm of the song visibility 123 album Bass Notes info_outline Sheet music of bass visibility 123 album Music Notes info_outline Sequence of instrument notes visibility 123 close aspect_ratio arrow_drop_down Show all diagrams layers Edit Lyrics cloud_done Save cancel Cancel Edit delete_forever Delete this Version 3/4Time Signature arrow_back0SHIFT arrow_forward BPM doneclose NDmNNNNDNNNNNNNCmNNNNNNNGNNNNNNNANNNNNNNDNNNNNNNCmNNNNNNNGNNNNNNNANNNNNNNDNNNNNNNCmNNNNNNNGNNNNNNNANNNNNNNDNNNNNNNCmNNNNNNNGNNNNNNNANNNNNNNNDNNNNNCmNNNNNNNNNGNNNNNNNANNNNNNNDNNNNNNNCmNNNNNNNGNNNNNNNANNNNNNNDNNNNNNNCmNNNNNNNGNNNNNNNANNNNNNNDNNNNNNNCmNNNNNNNGNNNNNNNANNNNNDNNNNNNNNNCmNNNNNNNGNNNNNNNANNNNNNNDNNNNNNNCmNNNNNNNGNNNNNNNANNNNNNNDNNNNNNNCmNNNNNNNGNNNNNNNANNNNNNNDNNNNNNNCmNNNNNNNGNNNNNNNANNNNNNNDNNNNNNCmNNNNNNNGNNNNNNNNANNNNNNNDNNNNNNNCmNNNNNNNGNNNNNNNANNNNNNNDNNNNNNNCmNNNNNNNGNNNNNNNANNNNNNNDNNNNNNNCmNNNNNNNGNNNNNNNANNNNNDNNNNNNNNNCmNNNNNNNGNNNNNNNANNNNNNNDNNNNNNNCmNNNNNNNGNNNNNNNANNNNNNNDNNNNNNNCmNNNNNNNGNNNNNNNANNNNNNNDNNNNNNNCmNNNNNNNGNNNNNNNANNNNNNNDNNNNNNCmNNNNNNNNGNNNNNNNANNNNNNNDNNNNNNNCmNNNNNNNGNNNNNNNANNNNNNNDNNNNNNNCmNNNNNNNGNNNNNNANNNNNNNNNNNNNNNNNNNN Private lock Publiclanguage file_download PDF & Tabs music_note Download Midi clear ChordU Learn Any Instrument ChordU has always been about simplicity and ease of access. We are constantly improving our accuracy through research and development. We hope you have a wonderful experience with us. Hello Again !! Please login to your ChordU account. mail Login with Email Forgot Password? Don't have an account? Sign Up trending_flat clearsecurity Forgot Password No worries, enter your registered email to reset your password keyboard_backspace Back to Login Watchfullscreen. 4 years ago. Via Vallen - Bidadari Kesleo - OM.SERA (Official Music Video) album Simplified info_outline Major & minor chords only visibility 123 album Advanced info_outline Includes 6,7,aug,hdim7 chords visibility 123 album Bass info_outline Advance chords for bass visibility 123 album Edited info_outline All Edited versions visibility 123 album Chords Notes info_outline Notes in chords visibility 123 album Simple Notes info_outline Rhythm of the song visibility 123 album Bass Notes info_outline Sheet music of bass visibility 123 album Music Notes info_outline Sequence of instrument notes visibility 123 close aspect_ratio arrow_drop_down Show all diagrams layers Edit Lyrics cloud_done Save cancel Cancel Edit delete_forever Delete this Version 3/4Time Signature arrow_back0SHIFT arrow_forward BPM doneclose NNNNFNNNNNNNNNNNNNNNNNNNNNGNNNNNNNNNEmNNNNNNNNNCNNNNNNNNDNNNNNNNNGNNNNNNNNEmNNNNNNNNCNNNNNNNNNDNNNNNNNNGNNNNNNNNEmNNNNNNNNCNNNNNNNNNDNNNNNNNNGNNNNNNNNEmNNNNNNNNCNNNNNNNNNDNNNNNNNNGNNNNNNNNEmNNNNNNNNCNNNNNNNNNDNNNNNNNNGNNNNNNNNEmNNNNNNNNCNNNNNNNNDNNNNNNNNNGNNNNNNNNEmNNNNNNNNCNNNNNNNNDNNNNNNNNNGNNNNNNNNNEmNNNNNNNCNNNNNNNNDNNNNNNNNGNNNNNNNNNEmNNNNNNNNCNNNNNNNNDNNNNNNNNGNNNNNNNNNEmNNNNNNNNCNNNNNNNNDNNNNNNNNGNNNNNNNNNEmNNNNNNNNCNNNNNNNNDNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN Private lock Publiclanguage file_download PDF & Tabs music_note Download Midi clear ChordU Learn Any Instrument ChordU has always been about simplicity and ease of access. We are constantly improving our accuracy through research and development. We hope you have a wonderful experience with us. Hello Again !! Please login to your ChordU account. mail Login with Email Forgot Password? Don't have an account? Sign Up trending_flat clearsecurity Forgot Password No worries, enter your registered email to reset your password keyboard_backspace Back to Login

Halo Bogeng, kali ini saya mau membagikan Chord Dasar dan original Kunci Gitar Bidadari Kesleo - Nella Kharisma yang bisa bogeng gunakan untuk bernyanyi dan bersantai ria bersama teman-teman bogeng dimanapun berada. Kunci Gitar Bidadari Kesleo - Nella Kharisma

Androidiçin 500 Lagu Pop Terbaru 3.1 APK indir. Top 500 Indonesian pop songs latest and best selection of 2018 Download& View Chord Bidadari Kesleo as PDF for free. More details. Words: 117; Pages: 2; Preview; Full text; bidadari kesleo intro:c am f g c am untumu ono kawate f g ono lomboke,ono kangkunge c am yen mrenges,ketok aslimu f g ketok wagumu,ketok mrongosmu # c am bidadari keseleo mekso-mekso banget nganggo kawat abang ijo f pupure medok mirok chordgitar bidadari kesleo - nella kharisma - Hallo sahabat Chord Gitar Terlengkap, Pada Artikel yang anda baca kali ini dengan judul chord gitar bidadari kesleo - nella kharisma, kami telah mempersiapkan artikel ini dengan baik untuk anda baca dan ambil informasi didalamnya. mudah-mudahan isi postingan Artikel nella kharisma, yang kami tulis ini dapat anda pahami. baiklah, selamat membaca. Db Eb Cm Ab Bbm Fm C Bb Abm F] Chords for Via Vallen - Bidadari Kesleo | Dangdut [OFFICIAL] with song key, BPM, capo transposer, play along with guitar, piano, ukulele & mandolin. 500Lagu Pop Terbaru 3.1 download APK per Android. Top 500 Indonesian pop songs latest and best selection of 2018 .
  • l4j3xe7oo7.pages.dev/944
  • l4j3xe7oo7.pages.dev/416
  • l4j3xe7oo7.pages.dev/564
  • l4j3xe7oo7.pages.dev/711
  • l4j3xe7oo7.pages.dev/35
  • l4j3xe7oo7.pages.dev/886
  • l4j3xe7oo7.pages.dev/622
  • l4j3xe7oo7.pages.dev/483
  • l4j3xe7oo7.pages.dev/192
  • l4j3xe7oo7.pages.dev/906
  • l4j3xe7oo7.pages.dev/361
  • l4j3xe7oo7.pages.dev/99
  • l4j3xe7oo7.pages.dev/540
  • l4j3xe7oo7.pages.dev/59
  • l4j3xe7oo7.pages.dev/959
  • chord via vallen bidadari kesleo